Inquiry Regarding CRISPResso2 for PE250 Amplicon Sequencing #510
Replies: 2 comments
-
|
Hi @Kathrina1030, Double check that your guide sequence is really that long. Usually, the guide spacer sequence is 20-23bp long. To increase the plot window around the cut site, you can use the parameter --plot_window_size If you would like to increase the quantification window size (the length of region where changes will make the read count as 'modified') you can increase the parameter --quantification_window_size. Note that you cannot include bases in the quantification window or the plot window if they are outside the amplicon length so the plot_window_size and quantificiation_window_size must be smaller than the distance between your gRNA cut site and the end of the amplicon. To see the exact error produced by your batch run, you can run the CRISPResso command as listed in your error. |
Beta Was this translation helpful? Give feedback.
-
|
Hi @kclem , |
Beta Was this translation helpful? Give feedback.
Uh oh!
There was an error while loading. Please reload this page.
-
Hi Luca's Team,
I am a PhD student who used CRISPResso2 for editing efficiency analysis. However, my gRNA is very long and CRISPResso 2.2.14 can't analyse with full guide RNA sequence and it will show an error as follows.
Therefore, I can only shorten the guideRNA sequence in the setting to analyse the data. Is it possible that CRISPResso2 can analyse the long guideRNA window? In addtion, I am unsure whether CRISPResso2 is suitable for analysing amplicon sequencing data generated by the PE250 strategy. My amplicon is 309 bp long with an overlap of over 30 bp in the PE250 strategy. I tested the same sample with both the PE150 and PE250 strategies and observed a discrepancy in the editing efficiency: 51% with PE150, but 0% with PE250. Should I change the setting to achieve a successful analysis?
Benchling link of targeted adenosine, guide window and amplicon length:
https://benchling.com/s/seq-faqCsNPHOtXe5x5E1Ttt?m=slm-xtPXhwIbkRQDQJM9U7rQ
(the triangle is targeted adenosine, I want to detect the conversion rate from adenosine to guanosine)
setting:
CRISPRessoBatch --batch_settings /home/ngs/batchhdr.txt -a GTACTTCCTTTGAATATTGACAAGGCTGACACAGGCAAGAATTTAGTCACGCTCCCCAATACAACTGCCACTGCAATTCTGTGCAGTGACGAGACTATCTAGCTGGAGCCTGAAGTTCTCTTTTCAGGGCCTCGTCAAGCATTTGAGTTTCCTCAAATCAATTACCAGAAGTATTGTGGGAAACCTTACACATATGCGTA -g ATTCTGTGCAGTGACGAGACTATCTAGCTGGAGCCTGAAGTTCTCTTTTC -n file -q 30 -qwc 76-125 -w 20 -wc -10 -bo /home/ngs/outputs --conversion_nuc_from A --conversion_nuc_to G --discard_indel_reads --plot_window_size 20 --min_frequency_alleles_around_cut_to_plot 0.2 --max_rows_alleles_around_cut_to_plot 50 --expand_allele_plots_by_quantification --allele_plot_pcts_only_for_assigned_reference --annotate_wildtype_allele . --base_editor_output
Input file:
PE150_L4_1.fq.gz
PE150_L4_2.fq.gz
PE250_L1_1.fq.gz
PE250_L1_2.fq.gz
PE150 output file:
CRISPRessoBatch_on_PE150.zip
PE250 output file:
file:///D:/PE250data/PE250%20trouble%20shooting/1205%20PE250%201st%20attempt/1st%20analysis/CRISPRessoBatch_on_1205ad1_2_be/CRISPResso_on_54.html
Looking forward to your reply. Feel free to contact me if you need anything from my end.
Cheers,
Kathrina
Beta Was this translation helpful? Give feedback.
All reactions