Error with test run file and SAM headers

[sq101]

Dear CRISPRLungo Team,

Thank you very much for the tool! I have installed the tool but I obtain the error below when I run the demo command on the test version,
cd data
CRISPRlungo PD1.fasta --control Nanopore_umi_Run_test_control_wo_chi.fastq Nanopore_umi_Run_test_wo_chi.fastq regular_output ggcgccctggccagtcgtct

Error:

Cleavage site : 2369 Start filtering module ... [E::hts_open_format] Failed to open file "regular_output/align/Control_alignment.sam" : No such file or directory Traceback (most recent call last): File "/PATH/TO/.conda/envs/crisprlungo/bin/CRISPRlungo", line 6, in <module> sys.exit(main()) File "/PATH/TO/bin/CRISPRLungo/src/CRISPRlungo.py", line 513, in main edited_dictionary, controll_dictionary, List_of_valid_IDs, control_reads_cnt, edited_reads_cnt = mutation_analysis.analysis_function_with_control( File "/PATH/TO/bin/CRISPRLungo/src/CRISPRlungo_mutation_analysis.py", line 1106, in analysis_function_with_control control1, control_reads_cnt = quant_unique_indels(samfile_path2) File "/PATH/TO/bin/CRISPRLungo/src/CRISPRlungo_mutation_analysis.py", line 529, in quant_unique_indels samfile = pysam.AlignmentFile(samfile_path, 'r') File "pysam/libcalignmentfile.pyx", line 751, in pysam.libcalignmentfile.AlignmentFile.__cinit__ File "pysam/libcalignmentfile.pyx", line 950, in pysam.libcalignmentfile.AlignmentFile._open FileNotFoundError: [Errno 2] could not open alignment file regular_output/align/Control_alignment.sam: No such file or directory

I have also tried running the command on a fastq.gz of my own, and I obtained a different error:

CRISPRlungo /PATH/TO/GENOME/genome.fasta sample.fastq.gz results $SEQUENCE

with the error message being:

Cleavage site : 1295346353 minimap2 aligning sample.fastq.gz ... Done 1.11 s Traceback (most recent call last): File "/PATH/TO/.conda/envs/crisprlungo/bin/CRISPRlungo", line 6, in <module> sys.exit(main()) File "/PATH/TO/bin/CRISPRLungo/src/CRISPRlungo.py", line 572, in main run_triple_minimap2(ref_index, File "/PATH/TO/bin/CRISPRLungo/src/CRISPRlungo_minimap.py", line 75, in run_triple_minimap2 check_SA, read_out = soft_clipped(output_path + f'/{n}_align.sam', output_path + f'/{n+1}_soft.{file_format}', len_cutoff, fasta_check) File "/PATH/TO/bin/CRISPRLungo/src/CRISPRlungo_minimap.py", line 23, in soft_clipped with pysam.AlignmentFile(align_file_1) as f1, open(output_file, 'w') as fw: File "pysam/libcalignmentfile.pyx", line 751, in pysam.libcalignmentfile.AlignmentFile.__cinit__ File "pysam/libcalignmentfile.pyx", line 1000, in pysam.libcalignmentfile.AlignmentFile._open ValueError: file has no sequences defined (mode='r') - is it SAM/BAM format? Consider opening with check_sq=False

I installed the tool with conda as speficied in your Github. I would be very grateful if you could help me out.
Best regards!